Прејди на содржината

Хаплогрупа Q-M242

Од Википедија — слободната енциклопедија
Хаплогрупа Q
Распространетост на хаплогрупата Q-M242.[1]
Можно време на потеклопред 17.200 до 31.700 години[2][3][4] (пред околу 24.500 години)
Можно место на потеклоЦентрална Азија,[5][6] Југоцентрален Сибир[3]
ПредокP1-M45
ПотомциQ1 (L232/S432)
Дефинирање на мутацииM242 rs8179021
Највисоки фреквенцииКети 93.8%,[7] Индијанци од Јужна Америка 92%,[8] Туркменци од Каракалпакистан 73%,[9] Селкупи 66.4%.,[7] Алтаинци 63.6%.,[10] Челканци 60.0%.,[10] Инуити од Генланд 54%,[11] Тубалари 41%,[10] Сибирски Татари 38%,[12] Инуити, американски домородци, Акша народ, Мон-Кмери и некои племиња од Асам

Хаплогрупата Q или Q-M242 е хаплогрупа на ДНК на Y-хромозомот. Има една примарна потклада, Хаплогрупата Q1 (L232/S432), која вклучува бројни потклади кои се земени во примероци и идентификувани кај мажите од денешнината.

Q-M242 е доминантна Y-ДНК хаплогрупа меѓу Индијанците и неколку народи од Централна Азија и Северен Сибир.

Хаплогрупата Q-M242 е една од двете гранки на P-P226 (M45), а другата е R-M207.[13]

Се верува дека Q-M242 се појавила околу областа Алтајски Планини (или Јужен Централен Сибир),[3] пред околу 17.000[3] до 31.700 години. Сепак, прашањето останува нејасно поради ограничените големини на примероците и менувањето на дефинициите на Хаплогрупата Q: раните дефиниции користеле комбинација на еднонуклеотидните полиморфизми M242, P36.2 и MEH2 како дефинирање на мутациите.

Техничка спецификација на мутацијата

[уреди | уреди извор]

Полиморфизмот, „M242“, е C→T транзиција што се наоѓа во интронот 1 (IVS-866) на генот DBY и е откриен од Марк Сејелстад и сор. во 2003 година.[14] Техничките детали за M242 се:

Промена на нуклеотидите: C до T
Позиција (основен пар): 180
Вкупна големина (основни парови): 366
Напред 5′→ 3′: aactcttgataaaccgtgctg
Обратна 5′→ 3′: tccaatctcaattcatgcctc

Потклади

[уреди | уреди извор]

Во филогенетиката на Y хромозомот, поткладите се гранки на хаплогрупата. Овие потклади се дефинирани и со еднонуклеотидни полиморфизми (SNP) или полиморфизми со уникатен настан (UEPs). Хаплогрупата Q-M242, според најновата достапна филогенија има помеѓу 15 и 21 потклади. Научното разбирање на овие потклади брзо се менува. Многу клучни SNP и соодветните потклади биле непознати за истражувачите во времето на објавувањето, и исклучени се дури и од неодамнешните истражувања. Ова го прави предизвик разбирањето на значењето на поединечните миграциски патеки.

Филогенетски дрва

[уреди | уреди извор]

Постојат неколку потврдени и предложени филогенетски дрва достапни за хаплогрупата Q-M242. Научно прифатениот е Конзорциумот за хромозомот Y (YCC) објавен во Карафет 2008 година и последователно ажуриран. Нацрт-дрвото е обезбедено од Томас Кран во Центарот за геномски истражувања во Хјустон, Тексас. Меѓународното здружение за генетска генеалогија (ISOGG) исто така обезбедува аматерско дрво.

Дрвото ISOGG од 2015 година

[уреди | уреди извор]

Поткладите на Хаплогрупата Q-M242 со нивната дефинирачка мутација (и), според дрвото ISOGG од 2015 година се дадени подолу. Прикажани се првите три нивоа на потклади. Дополнителни детали се дадени на страниците на статиите на поврзаните гранки.

Нацрт дрво на Центарот за геномски истражувања

[уреди | уреди извор]

Подолу е дрво од 2012 година од Томас Кран од Центарот за геномски истражувања. Прикажани се првите три нивоа на потклади. Дополнителни детали се дадени на страниците на статиите на поврзаните гранки.[15]

Дрвото на конзорциумот на хромозомот Y

[уреди | уреди извор]

Ова е дрвото од 2008 година направено од Конзорциумот на Y хромозом (YCC).[16] Последователните ажурирања биле тримесечни и двегодишни. Тековната верзија е ревизија на ажурирањето од 2010 година.[17] Прикажани се првите три нивоа на потклади. Дополнителни детали се дадени на страниците на статиите на поврзаните гранки.

Филогенетски варијанти

[уреди | уреди извор]

Поткладата (под Q-MEH2) предложена од Шарма (2007), која покажува полиморфизам (ss4bp, rs41352448) на 72.314 позиција на човечкиот псевдоген арилсулфатаза D, не е претставена во ниту едно тековно дрво под Q-MEH2.[18] Најверојатно објаснување за ова би можело да биде миграцијата на предците на поединци кои носат Q-MEH2 до индискиот потконтинент проследено со автохтона диференцијација на Q-ss4bp.[6]

Распространетост

[уреди | уреди извор]

Неколку гранки на хаплогрупата Q-M242 се доминантни претколумбиска машка лоза кај домородните народи на Америка. Повеќето од нив се потомци на главните основачки групи кои мигрирале од Азија во Америка со преминување на Беринговиот Проток.[3] Овие мали групи основачи мора да вклучуваат мажи од лозата Q-M346, Q-L54, Q-Z780 и Q-M3. Во Северна Америка, исто така се пронајдени две други Q-лоза. Тоа се Q-P89.1 (под Q-MEH2) и Q-NWT01. Тие можеби не биле од луѓето што го минале Беринговиот Проток, туку потекнуваат од подоцнежните имигранти кои патувале по брегот на Далечната Источна Азија, а потоа и низ Америка користејќи чамци.

Не е јасно дали сегашната фреквенција на лозата Q-M242 ја претставува нивната фреквенција во времето на имиграцијата или е резултат на промените во малата популација основачи со текот на времето. Без разлика, Q-M242 доминира во татковската лоза во Америка.

Северна Америка

[уреди | уреди извор]

Кај домородните жители на Северна Америка, Q-M242 се наоѓа кај говорителите на јазикот На-Дене со просечна стапка од 68%. Највисоката фреквенција е 92,3% кај луѓе од племето Навахо, проследено со 78,1% во Апачи,[3] 87%[3] во SC Апачи,[19] и околу 80% во северноамериканските ескими (Инуити, Јупик) – популациите на Алеути. (Q-M3 зазема 46% меѓу Q во Северна Америка)[20]

Од друга страна, на Гренланд е пронајден поединец стар 4000 години, кој припаѓа на Q1a-MEH2*. Изненадувачки, се покажа дека тој е генетски поблизок со жителите на Далечниот Исток, како што се луѓето Корјаци и Чукчи, наместо со домородните Американци.[21] Денес, фреквенцијата на Q изнесува 53,7% (122/227: 70 Q-NWT01, 52 Q-M3) на Гренланд, што покажува највисока во источниот дел на Сермерсок со 82% и најниска во Кеката со 30%.[11]

Q-M242 се проценува дека зазема 3,1% од целото американско население во 2010 година:[22]

Етничка припадност Процент од населението на САД † Фреквенција на хаплогрупата Q
бели луѓе 63,7% Q-P36* 0,6% и Q-M3 0,1%
шпанско потекло 16,3% Q-P36* 3,8% и Q-M3 7,9%
црно население 12,6% Q-P36* (xM3) 0,2%
азиско население 4,8% ~0%
Индијанци ‡ 0,9% Q-P36* 31,2% & Q-M3 26,9%
Извор:[22] † Според податоците од Националниот попис на населението на САД (2010)

‡ копното и Алјаска, не вклучувајќи ги островите на Тихиот Океан

Мезоамерика и Јужна Америка

[уреди | уреди извор]

Хаплогрупата Q-M242 е пронајдена кај приближно 94% од домородните народи во Мезоамерика и Јужна Америка.[8]

Фреквенциите на Q кај целото машко население во секоја земја достигнуваат како што следува:

Q-M242 потекнува од Азија (регионот Алтај) и е широко распространет низ неа.[3] Q-M242 се наоѓа во Русија, Сибир (Кеци, Селкупи, Сибирски Јупик, Нивхи, народ Чукчи,[36] Јукагири, Туванци,[37] Алтајци,[10] Корјаци, итн.), Монголија,[38] Кина,[39][40] Ујгури,[38] Тибет,[41] Кореја, Јапонија, Индонезија,[42] Виетнам,[43] Тајланд,[44] Индија,[45] Пакистан,[45] Авганистан, Иран,[46] Ирак, Саудиска Арабија, Туркменистан, Узбекистан и така натаму. (За детали, видете подолу.)

Северна Азија

[уреди | уреди извор]

Во Сибир, регионите помеѓу Алтајски Планини и Бајкалското Езеро, кои се познати по многу праисториски култури и како најверојатно родно место на хаплогрупата Q, покажуваат високи фреквенции на Q-M242. Во една студија (Дулик 2012),[47] Q-M242 (најчесто Q-M346 вклучувајќи некои Q-M3) е пронајден во 24,3% (46/189: 45 Q-M346, 1 Q-M25) од сите примероци од Алтај. Меѓу нив, Челканците покажуваат најголема фреквенција од 60,0% (15/25: сите Q-M346), проследени со Тубалари со 41% (11/27: 1 Q-M25, 10 Q-M346) и Алтајци Кижи со 17% (20/120). Во една поранешна студија, Q-M242 е пронајден кај 4,2% од јужните Алтајци и 32,0% од северните Алтајци со најголема фреквенција од 63,6% во Курмач-Бајгол. Фреквенцијата достигнува 13,7% (20/146) во цели примероци.[10] Во друга студија,[48] фреквенцијата се зголемува до 25,8% (23/89: сите Q-M346) кај Алтајците. Врз основа на резултатите од овие студии, просечната фреквенција на Q-M242 кај Алтајците е околу 21%.

Тува, која се наоѓа на источната страна на Република Алтај и западно од Бајкалското Езеро, како и на северната страна на Монголија, покажува поголема фреквенција на Q-M242. Го има во 14%[49] ~38,0% (41/108)[48] од Туванците. Исто така, Тоџинците во источна Тува ја покажуваат фреквенцијата на ≤22,2% (8/36 P(xR1)[50])~38,5% (10/26, сите Q-M346 (xM3)).[48] Значи, просечната фреквенција на Q-M242 кај Туванците-Тоџини во Република Тува е околу 25%. Хаплогрупата Q-M242 е пронајдена кај 5,9% (3/51) од примерокот Туванци од селото Канаси, 9,8% (5/51) од примерокот Туванци од селото Хему и 62,5% (30/ 48) примерок од Туванци од селото Баихаба во северниот дел на Шјинџјианг во близина на меѓународната граница со Република Алтај.[51]

Кај сибирските Татари, подгрупата Иштијако-Токуз од групата Тобол-Иртиш има фреквенција од Q-M242 на 38%.[12]

Највисоките фреквенции на Q-M242 во Евроазија се забележани кај Кетците (централен Сибир) со 93,8% (45/48) и во Селкупите (северен Сибир) со 66,4% (87/131). Руските етнографи веруваат дека нивните антички места биле подалеку на југ, во областа на планините Алтај и Сајан[3] (регион Алтај-Сајан). Нивната популација моментално е мала по број, со нешто помалку од 1.500 и 5.000 соодветно. Во лингвистичката антропологија, кетскиот јазик е значаен бидејќи во моментов е единствениот преживеан во семејството на енисејски јазици, кој е поврзан од некои научници со домородните американски На-дене јазици[52] и, поконтроверзно, со јазикот на Хуните. (Види: L. Lieti, E. Pulleybank,[53] E. Vajda,[54] A. Vovin,[55] итн.) Q-M346 е исто така пронајден со пониски стапки кај Сојоти (7,1%, Q-M346), Хакази (6,3%, Q-M346), Калмици (3,4%, Q-M25, Q-M346)[48] и Ханти,[56] и така натаму.

Во далечниот источен Сибир, Q-M242 се наоѓа во 35,3% од Нивхите во долниот дел на реката Амур и 33,3% од луѓето Чукчи и 39,2% од сибирскиот народ Јупик во Чукотка (Чукотски Полуостров).[36] Го има кај 30,8% од Јукагирите кои живеат во сливот на реката Колима, која се наоѓа северозападно од Камчатка.[37] Се наоѓа и во 15% (Q1a* 9%, Q-M3 6%) од Корјаксите во Камчатка.[25]

Источна Азија

[уреди | уреди извор]

Во некои студии, различни подгрупи на Q-M242 се забележани во Монголија. Q1a2-M346 (најчесто Q-L330) зафаќа 1,4[25] ~3,1%[46] од Монголците (1/2~2/3 меѓу Q примероците), проследено со Q1a1a1-M120 (0,25[25] ~1,25%[46]), Q1a1b-M25 (0,25[25] ~ 0,63%[46]), Q1b-M378. Во друга студија, Q се наоѓа кај 4% од Монголите.[8] Карафет и сор. (2018) нашол Q-L54(xM3) во 2,7% (2/75) и Q-M25 во други 2,7% (2/75) за вкупно 5,3% (4/75) хаплогрупа Q Y-DNA во примерок на Калха Монголците од Улан Батор, Монголија.[57] Врз основа на овие студии, просечната фреквенција на Q-M242 кај Монголите се проценува дека е околу 4-5%.

Сепак, повеќето од луѓето Q-M242 во Источна Азија припаѓаат на поткладата Q-M120, која најинтензивно се дистрибуира низ северна Кина (провинциите чии главни градови се наоѓаат северно до линијата на реката Хуаи - планините Чин). Q-M242 се движела од 4~8% во северозападна Кина (Шјинџјианг, Гансу, Шенси), северна Кина (Шанкси, Хебеи), централна Кина (Хенан) и горноисточна Кина (Шандунг) до 3~4% во североисточна Кина. Просечната фреквенција на Q-M242 во северна Кина е околу 4,5%. Сепак, се намалува на околу 2% во јужна Кина.[39][40] Во една студија објавена во 2011 година, истражувачите пронашле Q-M242 во 3,3% (12/361) од примероците на неповрзани Хан-кинески машки волонтери на Универзитетот Фудан во Шангај со потекло од цела Кина, иако мнозинството доаѓа од источна Кина.[58] Во друга студија објавена во 2011 година, Хуа Жонг и сор. ја нашле хаплогрупата Q-M242 во 3,99% (34/853, вклучувајќи 30/853 Q-M120, 3/853 Q-M346 и 1/853 Q-M25) од базен примероци од Хан Кинез од северна Кина и 1,71% (15/876, вклучително и 14/876 Q-M120 и 1/876 Q-M346) од базен примероци од Хан Кинез од јужна Кина.[59] Q1a1-M120 е единствен за источноазијците. Не се среќава во Југоисточна Азија, освен со мала разновидност во Y-STR меѓу јужните Хански Кинези, што укажува дека се ширела за време на неолитот со кинеската култура на Хан до јужна Кина од северна Кина. Q1a3*-M346 се наоѓа само меѓу Хуи и јужните Хан Кинезите во Југоисточна Азија во јужна Кина, но воопшто не се наоѓа кај домородните народи што не се Хан. Дошла од северна Кина (североисточна Азија) со Хан. Само домородните Американци имаат Q1a3a-M3, што е потомок на хаплогрупата на Q1a3*-M346. Америка била населена со мигранти од Централна Азија во праисторијата.[60] Q1a1 е потврдено во над 3.000 години старите останки на Хан кинеските предци во династиите Шанг и Џоу од археолошкиот локалитет Хенгбеи.[61] Современите северни Ханкинески Y хаплогрупи и мтДНК се совпаѓаат со оние на старите северни кинески предци Хан пред 3.000 години од археолошкиот локалитет Хенгбеи. Земени се 89 антички примероци. Y хаплогрупите O3a, O3a3, M, O2a, Q1a1 и O* биле пронајдени во примероците на Хенгбеи.[62]

Q-M242 е пронајден со забележителна фреквенција во некои примероци на Ујгури: 15,38% (22/143, вклучувајќи 6/143 Q-M378, 5/143 Q-P36.2*, 4/143 Q-M120, 4/143 Q-M346, 1/143 Q-M25) на примерок од Ујгури од областа Турпан (吐鲁番地区),[63] 7,9% (6/76, вклучувајќи 2/76 Q1b1-L215/Page82/S325, 1/76 Q1a2-M346*, 1/76 Q1a1a1-M120, 1/76 Q1a2a1c-L330*, 1/76 Q1a2a1c1-L332) од примерок од Долан Ујгури (刀郎人) од округот Хорикол и округот Хорикол 7%[64] (37/478, вклучувајќи ги и 24/478 Q-M346, 7/478 Q-P36.2*, 5/478 Q-M120) примерок од Ујгури од областа Хотан (和田地区).[65] Сепак, други студии ја пронајдоа хаплогрупата Q во многу помали проценти од примероците на Ујгур: 3,0% (2/67) Q-P36 ујгур,[66] 1,6% (1/64) Q-M120 лоп-ујгур (罗布人).[64] Хаплогрупата Q не беше забележана во примерок од 39 керијански ујгури (克里雅人) од селото Дарја Боји, сместено на реката Керија длабоко во пустината Такламакан.[64]

Хаплогрупата Q била забележана кај 3,2% (5/156: 2 Q-M120, 3 Q-M346) на мажи во Тибет во една студија[41] и кај 1,23% (29/2354) од мажите во Тибет во друга студија,[67] но оваа хаплогрупа не била забележана во примерок на мажи од Тибет (n =105) во трета студија.[66]

Се наоѓа кај околу 1,9% од Јужнокорејците,[68][69][70] покажувајќи ја најголемата фреквенција во Сеул и провинцијата Ќенгидо со 2,7% и се намалуваат оние на југ (Ким 2010). Пронајден е кај околу 0,3% од Јапонците[66][71][72][73][74] (со познати примери од Шизуока[66] и Сајтама[73]) и кај 0,3%[44] ~ 1,2%[75] кај Тајванците.

Поткладата Q1b-M378 се наоѓа и во Кина и нејзините соседни земји на многу ниски фреквенции. Постои низ цела Монголија, со ретки примери во Јапонија.[76]

Југоисточна Азија

[уреди | уреди извор]

Хаплогрупата Q покажува ниски фреквенции во Југоисточна Азија. Во една студија,[42] фреквенциите на хаплогрупата Q се 5,4% (2/37) во Индонезија, 3,1% (2/64) на Филипините, 2,5% (1/40) во Тајланд. Меѓутоа, други студии покажуваат фреквенции од 0% или близу 0% во тие земји.[44]

Во случајот на Виетнам, фреквенцијата е 7,1% во една студија на примерок од Виетнамци, пријавени дека се од јужен Виетнам[77][78] и 4,3% во примерок од луѓе од градот Хо Ши Мин во јужен Виетнам,[74] но 0% или под 1% во други студии во кои примероци се собрани во Ханој во северен Виетнам.[42][44][78] Значи, тешко е да се дефинираат просечните фреквенции. Сепак, Махолт и сор. (2020) тестирале примерок од педесет луѓе од северен Виетнам (сите до еден од нив од регионот на делтата на Црвената Река, а 42 од нив од Ханој) и откриле дека двајца од нив (4%) припаѓаат на К- М120.[79]

Само некои региони и етнички групи на континентот покажуваат високи фреквенции. Q-M242 е пронајден во 2,8% (3/106, сите Q-M346) во Мјанмар, а сите примероци Q се концентрирани во 18,8% во Иравади (2/11) и 7,1% Баго (1/14) регионите на југозапад. Мјанмар.[80] И, Q-M242 се наоѓа во 55,6% (15/27) кај племето Аха во северен Тајланд.[44]

Централна Азија

[уреди | уреди извор]

Во Централна Азија, јужните региони покажуваат повисоки фреквенции на Q од северните.

Во северните региони, Q-M242 се наоѓа кај околу 2%[81] ~ 6%[82][83] (просечно 4%) од Казаците. Студијата објавена во 2017 година ја открила хаплогрупата Q Y-DNA во 3,17% (41/1294) од голем број примероци од казахстанските племиња; сепак, хаплогрупата Q била концентрирана кај членовите на племето Кангли (27/40 = 67,5%), а била многу поретка меѓу другите племиња.[84] Племето Кангли е поврзано барем по име со претходните Канкали, а веројатно и со унијата Кангар. Хаплогрупата Q се наоѓа кај околу 2% од Киргизите.[46][82][83]

Во јужните региони, Q-M242 се наоѓа кај 5%[85] ~ 6%[82][83] од Таџикистанците. Карафет и сор. 2001 година го нашле P-DYS257 (xQ1b1a1a-M3, R-UTY2), што треба да биде приближно еквивалентно на хаплогрупата Q-M242 (xM3), во 4/54 = 7,4% од примерокот од Узбеци, очигледно земен во Узбекистан.[86] Велс и сор. 2001 година го нашле P-M45 (xM120, M124, M3, M173), што треба да биде приближно еквивалентно на мешавина од Q-M242 (xM120, M3) и R2-M479 (xR2a-M124), во 20/366 = 5,5% од базен примероци на Узбеци од седум различни региони на Узбекистан.[82] Ди Кристофаро и сор. 2013 година го нашле Q-M242 во 11/127 = 8,7% од базенот примероци на Узбеци од три различни провинции во Авганистан, вклучително и 5/94 Q-M242 (xM120, M25, M346, M378), 4/94 Q-M346, и 1/94 Q-M25 (10/94 = 10,6% Q-M242 вкупно) во примерок од Узбеци од провинцијата Јавзјан, чија северна граница се пробива со југоисточниот агол на Туркменистан и 1/28 Q-M242 (xM120, M25, M346, M378) во примерок од Узбеци од провинцијата Сар-е Пол.[46] Велс и сор. (2001) нашле P-M45 (xM120, M124, M3, M173) во 10,0% (3/30) од примерок Туркмени од Туркменистан, додека Карафет и сор. (2018) нашле Q-M25 во 50,0% (22/44) од друг примерок Туркмени од Туркменистан, така што фреквенцијата на хаплогрупата Q во таа земја сè уште не е јасна. Сепак, Гругни и сор. (2012) нашле Q-M242 во 42,6% (29/68) од примерок Туркмени од Голестан, Иран и Ди Кристофаро и сор. (2013) нашле Q-M25 во 31,1% (23/74) и Q-M346 во 2,7% (2/74) за вкупно 33,8% (25/74) Q-M242 во примерок од Туркмени од Јавзјан, Авганистан, така што фреквенцијата на Q-M242 може да достигне околу 40% кај Туркмените од Авганистан и Иран кои живеат во областите во непосредна близина на Туркменистан.

Q-M242 отпаѓа на 6,9% од Авганистанците во една студија (Haber 2012). Во друга студија (Cristofaro 2013) со поголемо земање примероци, фреквенцијата на Q се зголемува на 8,9% (45/507). Хаплогрупата Q се јавува на фреквенција од 8% (11/136) кај авганистанските Паштуни и 3% (5/142) кај авганистанските Таџикистанци.[87] Во оваа студија (Кристофаро 2013), Туркмените од провинцијата Јавзјан, која е соседна со Туркменистан, покажуваат најголема фреквенција од 33,8% (25/74: 23 Q-M25, 2 Q-M346), проследени со Узбеци со 8,7% (11/144 : 6 Q*, 1 Q-M25, 4 Q-M346).[46]

Југозападна Азија

[уреди | уреди извор]

Југозападна Азија покажува високи фреквенции на Q во северен Иран и постепено намалувајќи ги на југозапад.

Q-M242 учествува со 5,5% (52/938) во Иран според Гругни 2012 година, што покажува големо и добро распоредено земање примероци. Примероците Q (52) во студијата се состојат од различни потклади како што се Q* (3), Q-M120 (1), Q-M25 (30), Q-M346 (8), Q-M378 (10). Највисока фреквенција е со 42,6% (29/68, сите Q-M25) кај Туркмените од Голестан, проследено со 9,1% во Исфахан (персиски народ), 6,8% во Хорасан (персиски народ), 6% во Лорестан (Лурстан), 4,9% во Азербејџан Гарби (5,1% од Асирците и 4,8% од Азерите), 4,5% во Фарс (персиски народ) и така натаму.[88] Туркмените се познати како потомци на Турците Огузи кои изградиле многу турски империи и династии. Други студии исто така покажуваат слични фреквенции.[89][90][91]

Во една студија (Захери 2011), фреквенцијата на Q е 1,9% (3/154: сите Q-M378) кај Ирачаните (мочуришни Арапи) и 2,8% (4/143: 1 Q-M25, 3 Q-M378) кај мочуришните Арапи кои се познати како потомци на древните Сумери.[92]

Приближно 2,5% (4/157: 3 Q*, 1 Q-M346) од мажите во Саудиска Арабија припаѓаат на хаплогрупата Q. Таа, исто така, претставува 1,8% (3/164: 2 Q*, 1 Q-M346) во Обединетите Арапски Емирати и 0,8% (1/121: Q*) кај народите во Оман.[93][94]

Хаплогрупата Q-M242 е пронајдена и кај 1,1% (1/87, Q-P36) Сиријци[77] и 2,0% (18/914, 14 Q*, 4 Q-M25) кај Либанци.[95]

Приближно 2% (10/523: 9 Q*, 1 Q-M25) од мажите во Турција припаѓаат на хаплогрупата Q.[96] Во една студија (Gokcumen 2008), било откриено дека меѓу Турците кои припаѓаат на племето Афшар (едно од племињата на Турците Огузи) хаплогрупата Q-M242 е забележана со преваленца од 13%.[97]

Јужна Азија

[уреди | уреди извор]

Во Пакистан на источниот крај на Иранската Висорамнина, фреквенцијата на хаплогрупата Q-M242 е околу 2,2% (14/638)[98] ~ 3,4% (6/176).[99]

Во една студија (Sharma2007), Q-M242 е забележан кај 2,38% (15/630) од Индијците кои припаѓаат на различни региони и социјални категории. Она што е интересно е дека 14/15 примероци не припаѓаат на ниту една позната подгрупа на Q-M242, при што 4 од нив покажуваат нов (специфичен за Индија) „ss4bp“ алел под Q-MEH2. Оваа студија, исто така, ги одразува резултатите од некои поранешни студии (Sengupta 2006, Seielstad 2003). А, акумулираниот резултат (фреквенција) од 3 студии се покажа дека е 1,3% (21/1615), со 11 од 21 Q примероци.[6] (За повеќе информации, видете Y-ДНК хаплогрупи кај народи од Јужна Азија)

Во една регионална студија во Гуџарат (Западна Индија), Q-M242 била пронајдена со највисоки 12% (3/25) кај Нана Чаударис додека вкупниот процент во Гуџарат бил 2,8% (8/284).[100] Во друга студија, 2,6% од Тарус во областа Читван и 6,1% (3/49) од Хиндусите во Њу Делхи, главниот град на Индија се покажаа како Q-M242 позитивни.[101]

Во студија во која Q-M242 штотуку е класифицирана во P* групата, P* (x R1, R2) учествува со 9,7% (23/237: Чакма 13/89, Марма 4/60, Трипура 6/88) во три етнички групи на Бангладеш.[102] Во многу случаи, сите или поголемиот дел од P* (x R1, R2) значи Q-M242, а со тоа и повеќето P* (9,7%) примероци во таа студија може да се процени дека се Q-M242.

1,2% од Непалците во Катманду, главниот град на Непал и 3,2% од луѓето од Тибет се во Q-M242.[41]

3,3% од жителите на Шри Ланка[77] се исто така во Q-M242.

Q-M242 ја има низ повеќето европски земји на ниски фреквенции, а фреквенциите се намалуваат кон запад и кон југ.

Централна и Источна Европа

[уреди | уреди извор]

Во Централна-Источна Европа, Q-M242 го има кај околу 1,7% од мажите. Q-M242 се наоѓа кај околу 2% од Русите,[103] 1,5% од Белорусите,[104] 1,3% од Украинците 1,3% од Полјаците (Полска),[105] 2% од Чесите,[106] 1,5% од Словаците,[107] околу 2,2% од Унгарците, 1,2% од Романците,[108] 0,8 % од Молдавците,[109] и 0,5% (4/808: 2 Q-M378, 1 Q-M346, 1 Q-M25) од Бугарите.[110] Од друга страна, 3,1% од Секелите од Трансилванија (кои тврделе дека се потомци на Хуните на Атила) се покажало дека се P* (xR1-M173),[111] што практично значи Q-M242. Во поврзаниот проект за ДНК на фреквенцијата на Q-M25 кај Секелите достигнува 4,3%.[112][113]

Кавкаскиот регион покажува фреквенција од 1,2% според една студија,[90] но може да достигне над 4% во Азербејџан, со тоа што 4,9% од соседните Ирански Азербејџанци имаат Q-M242.[89] Тоа е 1,3% кај Грузијците и Ерменците соодветно, а ерменските потклади се состојат од Q-M378 (L245), Q-M346 и Q-M25.[114]

Северна Европа

[уреди | уреди извор]

Во Северна Европа, хаплогрупата Q опфаќа околу 2,5% од мажите. Според шведската база на податоци за хаплогрупи, 4,1% (27/664, заклучно со јануари 2016 година) од шведските мажи припаѓаат на Q-M242. Околу 2/3 од детално анализираните потклади на примероците припаѓаат на Q1a2b-F1161/L527 и околу 1/3 се во Q1a2a-L804. По окрузи, тие се дистрибуирани интензивно во јужниот регион (Јеталанд, да не се меша со Готланд), а ретко на север. Ако се пресметува повторно по тежини на окрузи-население, фреквенцијата на Q во Шведска достигнува 4,7%.

Во Норвешка, Q-M242 се наоѓа кај околу 2,6% (~4%[115]) од мажите, при што Q-L804 е почест од Q-F1161/L527.[116] Забележано е кај 1,6% од мажите во Данска, 3% на Фарските Острови (познато дека се поврзани со Викинзите).[117] Во една статија (Helgason et al.) за хаплотиповите на Исланѓаните, 7,2% (13/181) од мажите во Исланд се означени како R1b-гранка А, но тие всушност се Q-M242.[115] Од друга страна, тоа е 0,2% во Финска,[118] 4,6 % во Латвија,[119] 1,1 % во Литванија,[120] 0,5 % во Естонија.

Западна Европа

[уреди | уреди извор]

Во Западна Европа, хаплогрупата Q-M242 е забележана на многу ниски фреквенции, околу 0,5% во повеќето земји, како што се Германија, Франција, Обединетото Кралство итн., но во некои региони процентите се малку повисоки. Тоа е 2,1% во Швајцарија,[121] и достигнува 5,1% во регионот Лион (Рона-Алпи) во Франција.[122] Тоа е околу 4% во Шетланд во најсеверната Британија, а место во него покажува највисока бројка од 8%. Познато е дека Шетландските Острови биле населени од Викинзите. И, изненадувачки, Q-M242 во Шетланд (исто така во некои области на Скандинавија, Фарски Острови, Исланд и Обединетото Кралство) се покажало дека е генерички тесно поврзан со Q-M242 во Централна Азија. Исто така, Шетландски (нордиски) Q-M242 се открива дека е поврзан со некои Q-M242 на Азербејџанци (Азербејџан).[115]

Јужна Европа

[уреди | уреди извор]

Јужна Европа, исто така, покажува ниски фреквенции на Q околу 0,5%~1%, но некои региони покажуваат различни бројки. Тоа е 1,9% во континентална Хрватска, но достигнува 14,3% (13/91) на островите Хвар и 6,1% (8/132) на Корчула.[122] Исто така, тоа е околу 0,6% во Италија, но се зголемува на 2,5% (6/236) на Сицилија, каде што достигнува 16,7% (3/18) во регионот Мазара дел Вало, проследено со 7,1% (2/28) во Рагуза, 3,6% во Сцијака,[123] и 3,7 % во Белведере Маритимо.[124]

Од друга страна, според една студија (Behar 2004), 5,2% (23/441) од еврејските мажи Ашкенази припаѓаат на хаплогрупата Q-P36.[125] Подоцна било откриено дека ова е целосно поткладата Q-M378 и може да биде ограничена на Q-L245. Исто така, 2,3% (4/174)[126] ~ 5,6% (3/53)[127] од сефардските Евреи се во хаплогрупата Q

Хаплогрупата Q ретко се среќава низ Северна Африка. Забележано е кај 0,7% (1/147),[94] од Египќаните и кај 0,6% (1/156)[90] од алжирскиот народ. Изненадувачки, тоа е забележано и кај 0,8% (3/381, сите Q-M346) од мажите од Комори кои се наоѓаат помеѓу Источна Африка и Мадагаскар.

За да се комбинираат податоците погоре, се проценува дека Q-M242 е кај околу 3,1% од мажите во светот.

Распростанетост на поткладите

[уреди | уреди извор]

Y-ДНК Q примероци од антички локалитети

[уреди | уреди извор]
  • Јужен Централен Сибир (во близина на Алтај)
  • Северна Америка
  • Алтај (Западна Монголија)
    • Цагаан Асга и Тахилгат Узуур-5 Курган, најзападниот монголски Алтај, 2900YBP-4800YBP: 4 R1a1a1b2-Z93 (пр.н.е. 10C, 14C п.н.е., 2 период непознат), 3 Q1a2a1-L54 (период непознат), 1 Q-M242 (B.C. 28C), 1 C-M130 (BC 10C)[146]
  • Гренланд
    • Сакак (Килакисток), Гренланд, 4000 години пред сегашноста: Q1a-YP1500[147] (мтДНК D2a1)[21]
  • Кина
    • Локација Хенгбеи (гробишта на кралството Пенг од периодот на Западен Џоу), округот Џианг, Шанкси, 2800-3000 години п.с.: 9 Q1a1-M120, 2 O2a-M95, 1 N, 4 O3a2-P201, 2 O3, 4 O*[148]
      • Во друг труд, се анализира социјалниот статус на тие човечки остатоци од античкото кралство Пенг (倗国). аристократи: 3 Q1a1 (ничкум 2, лежечка 1), 2 O3a (лежечка 2), 1 N (поклони) / обични луѓе: 8 Q1a1 (ничкум 4, лежечка 4), 3 O3a (ничкум 1, лежечка 2), 3 O* (лежечка 3) / робови: 3 O3a, 2 O2a, 1 O* [149]
      • (cf) Пенгбо (倗伯), монарх на кралството Пенг се проценува како Q-M120.
    • Округот Пенгјанг, Нингсја, 2500 години пред сегашноста: сите 4 Q1a1-M120[148] (со многу животински коски и бронзени мечеви и друго оружје, итн.)
    • Хеигоулианг, Шјинџјианг, 2200 години пред сегашноста: 6 Q1a* (не Q1a1-M120, не Q1a1b-M25, не Q1a2-M3), 4 Q1b-M378, 2 Q* (не Q1a, не Q1b: не може да се одредат потклади):[150]
      • Во еден труд (Lihongjie 2012), авторот ги анализирал Y-ДНК-те на древните машки примероци од гробиштата во 2 или 1 век п.н.е. источно од басенот Баркол и во близина на градот Хами. Y-ДНК од 12 мажи ископани од локацијата припаѓа на Q-MEH2 (Q1a) или Q-M378 (Q1b). Мажите Q-M378 меѓу нив се сметале за домаќини на гробниците; половина од мажите Q-MEH2 се чини дека се домаќини, а другата половина се семтале за жртви.
    • Локацијата Џонгну во Баркол, Шјинџјианг, сите 3 Q-M3
      • Во ЛЛ Канг и сор. (2013), беше откриено дека три примероци од локација Ксионгну во Баркол, Шјинџјианг се Q-M3 (Q1a2a1a1). И, бидејќи Q-M3 најчесто се наоѓа кај Јенисејаните и домородните Американци, авторите сугерираат дека Ксионгну имале врски со говорителите на енисејските јазици.[151][152] Овие откритија од горенаведените трудови (Li 2012, Kang et al., 2013) имаат некои позитивни импликации врз сè уште не јасно потврдената теорија дека Ксионгну биле претходници на Хуните.
    • Монголски благородни погребувања во династијата Јуан, локалитетот Шужуанглу, најсеверната Хебеј Кина, 700 години пред сегашноста: сите 3 Q (не се анализирале потклади)[153]
      • (сф) Коргуз бил син на принцезата на Кублај Хан (元 世祖) и бил крал на племето Онгуд. Починал во 1298 година и бил повторно погребан во Шужуанглу во 1311 година од неговиот син. (Не мешајте го овој човек со гувернерот на Ујгурите, Коргуз, кој починал во 1242 година.) Племето Онгуд било потомок на племето Шатуо кое било племе на Ѓоктурци (западно турски каганат) и бил истакнат во периодот на петте династии и десетте кралства на Кина, градејќи три династии. Неговите две кралици биле принцези од династијата Јуан (внуки на Кублај Хан). Било многу важно за династијата Јуан да одржува брачен сојуз со племето Онгуд кое било главен помошник уште од периодот на Џингис-хан. Околу 16 принцези од династијата Јуан се омажиле за кралеви од племето Онгуд.

Поврзано

[уреди | уреди извор]

Y-ДНК Q-M242 потклади

[уреди | уреди извор]
  1. Balanovsky, Oleg; Gurianov, Vladimir; Zaporozhchenko, Valery; Balaganskaya, Olga; Urasin, Vadim; Zhabagin, Maxat; Grugni, Viola; Canada, Rebekah; Al-Zahery, Nadia; Raveane, Alessandro; Wen, Shao-Qing; Yan, Shi; Wang, Xianpin; Zalloua, Pierre; Marafi, Abdullah; Koshel, Sergey; Semino, Ornella; Tyler-Smith, Chris; Balanovska, Elena (February 2017). „Phylogeography of human Y-chromosome haplogroup Q3-L275 from an academic/citizen science collaboration“. BMC Evolutionary Biology. 17 (S1): 18. Bibcode:2017BMCEE..17S..18B. doi:10.1186/s12862-016-0870-2. PMC 5333174. PMID 28251872.
  2. Fagundes, Nelson J. R.; Kanitz, Ricardo; Eckert, Roberta; Valls, Ana C. S.; Bogo, Mauricio R.; Salzano, Francisco M.; Smith, David Glenn; Silva, Wilson A.; Zago, Marco A.; Ribeiro-Dos-Santos, Andrea K.; Santos, Sidney E. B.; Petzl-Erler, Maria Luiza; Bonatto, Sandro L. (2008). „Mitochondrial Population Genomics Supports a Single Pre-Clovis Origin with a Coastal Route for the Peopling of the Americas“ (PDF). American Journal of Human Genetics. 82 (3): 583–592. doi:10.1016/j.ajhg.2007.11.013. PMC 2427228. PMID 18313026. Посетено на 2009-11-19. Since the first studies, it has been found that extant Native American populations exhibit almost exclusively five "mtDNA haplogroups" (A–D and X)6 classified in the autochthonous haplogroups A2, B2, C1, D1, and X2a.7 Haplogroups A–D are found all over the New World and are frequent in Asia, supporting a northeastern Asian origin of these lineages
  3. 3,0 3,1 3,2 3,3 3,4 3,5 3,6 3,7 3,8 Zegura, S. L.; Karafet, TM; Zhivotovsky, LA; Hammer, MF (2004). „High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas“. Molecular Biology and Evolution. 21 (1): 164–75. doi:10.1093/molbev/msh009. PMID 14595095.
  4. YFull YTree v4.02
  5. Y-DNA Haplogroup Q and its Subclades - 2016
  6. 6,0 6,1 6,2 „A novel subgroup Q5 of human Y-chromosomal haplogroup Q-M242 in India“. BMC Evol. Biol. 7 (1): 232. 2007. doi:10.1186/1471-2148-7-232. PMC 2258157. PMID 18021436.
  7. 7,0 7,1 Karafet, T. M. (2002). „High Levels of Y-Chromosome Differentiation among Native Siberian Populations and the Genetic Signature of a Boreal Hunter-Gatherer Way of Life“. Human Biology. 74 (6): 761–789. doi:10.1353/hub.2003.0006. PMID 12617488. S2CID 9443804.
  8. 8,0 8,1 8,2 8,3 Bortolini, Maria-Catira; Salzano, Francisco M.; Thomas, Mark G.; Stuart, Steven; Nasanen, Selja P.K.; Bau, Claiton H.D.; Hutz, Mara H.; Layrisse, Zulay; и др. (September 2003). „Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas“. The American Journal of Human Genetics. 73 (3): 524–539. doi:10.1086/377588. PMC 1180678. PMID 12900798.
  9. https://www.researchgate.net/publication/310645015_Gene_pool_of_Turkmens_from_Karakalpakstan_in_their_Central_Asian_context_Y-chromosome_polymorphismПредлошка:Full citation needed
  10. 10,0 10,1 10,2 10,3 10,4 Kharkov, V. N.; Stepanov, V. A.; Medvedeva, O. F.; Spiridonova, M. G.; Voevoda, M. I.; Tadinova, V. N.; Puzyrev, V. P. (2007). „Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups“. Genetika. 43 (5): 675–687. doi:10.1134/S1022795407050110. PMID 17633562.
  11. 11,0 11,1 Katharina Olofsson, Jill; и др. (2015). „Peopling of the North Circumpolar Region – Insights from Y Chromosome STR and SNP Typing of Greenlanders“. PLOS ONE. 10 (1): e0116573. Bibcode:2015PLoSO..1016573O. doi:10.1371/journal.pone.0116573. PMC 4312058. PMID 25635810.
  12. 12,0 12,1 Пять генофондов пяти субэтносов сибирских татар
  13. Estes, Roberta (2020-09-12). „Y DNA Haplogroup P Gets a Brand-New Root – Plus Some Branches“. DNAeXplained - Genetic Genealogy (англиски). Посетено на 2024-01-21.
  14. Seielstad, Mark; Yuldasheva, Nadira; Singh, Nadia; Underhill, Peter; Oefner, Peter; Shen, Peidong; Wells, R. Spencer (2003). „A Novel Y-Chromosome Variant Puts an Upper Limit on the Timing of First Entry into the Americas“. The American Journal of Human Genetics. 73 (3): 700–705. doi:10.1086/377589. ISSN 0002-9297. PMC 1180698. PMID 12929085.
  15. Krahn, Thomas. „FTDNA Draft Y-DNA Tree (AKA YTree)“. Family Tree DNA. Архивирано од изворникот на 2015-08-15.
  16. Karafet, T. M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). „New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree“. Genome Research. 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.
  17. „Y-DNA Haplotree“. Family Tree DNA uses the Y-Chromosome Consortium tree and posts it on their website.
  18. That is because it is a value for the STR DYS435 with a value of 8--> 9 within haplogroup Q-M242 and the trend is to include only binary markers in phylogenetic trees. However, these are from studies where all current branches of the Q-M242 tree have not been tested. The problematic phylogeny sampling of early studies has been demonstrated by subsequent studies that have found Q-M346, Q-M378, and Q-M25 in South Asia.
  19. Malhi, RS; Gonzalez-Oliver, A; Schroeder, KB; Kemp, BM; Greenberg, JA; Dobrowski, SZ; Smith, DG; Resendez, A; Karafet, T (2008). „Distribution of Y chromosomes among native North Americans: a study of Athapaskan population history“. Am. J. Phys. Anthropol. 137 (4): 412–24. doi:10.1002/ajpa.20883. PMC 2584155. PMID 18618732.
  20. „Frequency Distribution of Y-DNA Haplogroup Q M3“. GeneTree. 2010. Архивирано од изворникот на 2009-11-04. Посетено на 2010-01-30.
  21. 21,0 21,1 Rasmussen, Morten; Li, Yingrui; Lindgreen, Stinus; Pedersen, Jakob Skou; Albrechtsen, Anders; Moltke, Ida; Metspalu, Mait; Metspalu, Ene; и др. (February 2010). „Ancient human genome sequence of an extinct Palaeo-Eskimo“. Nature. 463 (7282): 757–762. Bibcode:2010Natur.463..757R. doi:10.1038/nature08835. PMC 3951495. PMID 20148029.
  22. 22,0 22,1 Hammer; и др. (Dec 2006). „Population structure of Y chromosome SNP haplogroups in the United States and forensic implications for constructing Y chromosome STR databases“. Forensic Sci. Int. 164 (1): 45–55. doi:10.1016/j.forsciint.2005.11.013. PMID 16337103.
  23. Vullo, Carlos; и др. (2014). „Association between Y haplogroups and autosomal AIMs reveals intra-population substructure in Bolivian populations“. Int J Legal Med. 129 (4): 673–680. doi:10.1007/s00414-014-1025-x. PMID 24878616.
  24. Söchtig, Jens; и др. (2015). „Genomic insights on the ethno-history of the Maya and the 'Ladinos' from Guatemala“. BMC Genomics. 16 (1): 131. doi:10.1186/s12864-015-1339-1. PMC 4422311. PMID 25887241. => Guatemala population consists of about 40% Tribal Natives (Mayans)+60% Native (Spanish Speaking). According to this paper, 89% of Mayan and 25% of Ladinos belong to Y-DNA Q. Thus, 40*0.89+60*0.25=50.6%
  25. 25,0 25,1 25,2 25,3 25,4 25,5 25,6 25,7 25,8 Battaglia; и др. (2013). „The First Peopling of South America: New Evidence from Y-Chromosome Haplogroup Q“. PLOS ONE. 8 (8): e71390. Bibcode:2013PLoSO...871390B. doi:10.1371/journal.pone.0071390. PMC 3749222. PMID 23990949.
  26. Gaviria, A.; и др. (2013). „Characterization and Haplotype analysis of 11 Y-STR loci in Ecuadorian population“. Forensic Sci. Int. Genet. Suppl. 4 (1): e310–e311. doi:10.1016/j.fsigss.2013.10.158.
  27. Martínez-Cortés, G; и др. (2012). „Admixture and population structure in Mexican-Mestizos based on paternal lineages“. J. Hum. Genet. 57 (9): 568–74. doi:10.1038/jhg.2012.67. PMID 22832385.
  28. Lovo-Gómez, J; и др. (Sep 2007). „The genetic male legacy from El Salvador“. Forensic Sci. Int. 171 (2–3): 198–203. doi:10.1016/j.forsciint.2006.07.005. PMID 16916590.
  29. Grugni (2015). „Exploring the Y Chromosomal Ancestry of Modern Panamanians“. PLOS ONE. 10 (12): e0144223. Bibcode:2015PLoSO..1044223G. doi:10.1371/journal.pone.0144223. PMC 4670172. PMID 26636572.
  30. Rojas, Win; и др. (2010). „Genetic Make Up and Structure of Colombian Populations by Means of Uniparental and Biparental DNA Markers“. American Journal of Physical Anthropology. 143 (1): 13–20. doi:10.1002/ajpa.21270. PMID 20734436.=> (DANE, 2006) 86% of the whole Colombian population self-reported as of Mixed Ancestry, 3.4% as Native American, 10.5% as African-Columbian. In this paper, 12% (114/954) of MA, 95.7% (135/141) of NA, and 23.8% (5/21) of AC are turned out to be Y-DNA Q. Thus, 86*0.12+3.4*0.957+10.5*0.238=16.1%
  31. Núñez, Carolina; и др. (2012). „Y chromosome haplogroup diversity in a Mestizo population of Nicaragua“. Forensic Sci. Int. Genet. 6 (6): e192–e195. doi:10.1016/j.fsigen.2012.06.011. PMID 22770600. The author revised his previous paper, genotyping 2 more samples as haplogroup Q by Y-SNP test.
  32. Corach, Daniel; и др. (2010). „Inferring Continental Ancestry of Argentineans from Autosomal, Y-Chromosomal and Mitochondrial DNA“. Annals of Human Genetics. 74 (1): 65–76. doi:10.1111/j.1469-1809.2009.00556.x. PMID 20059473. |hdl-access= бара |hdl= (help)
  33. Ramallo; и др. (Dec 2009). „Comparison of Y-chromosome haplogroup frequencies in eight Provinces of Argentina“. Forensic Science International: Genetics Supplement Series. 2 (1): 431–432. doi:10.1016/j.fsigss.2009.08.047.
  34. Villalta, M.; Rodriguez, A.; González, L.; Arce, V.; Arrieta, G.; Morales, A.; Gusmão, L.; Espinoza, M. (August 2008). „Haplotype data for 12 Y-chromosome STR loci from Costa Rica“. Forensic Science International: Genetics Supplement Series. 1 (1): 252–254. doi:10.1016/j.fsigss.2007.10.101.
  35. Palha, T.; и др. (2012). „Disclosing the Genetic Structure of Brazil through Analysis of Male Lineages with Highly Discriminating Haplotypes“. PLOS ONE. 7 (7): e40007. Bibcode:2012PLoSO...740007P. doi:10.1371/journal.pone.0040007. PMC 3393733. PMID 22808085.=> about 80 out of 2,024 (3.95%) samples in the paper collected from all the regions of Brazil can be classified as Y-DNA Q.
  36. 36,0 36,1 Jeffrey, T.; и др. (Jan 2002). „The Dual Origin and Siberian Affinities of Native American Y Chromosomes“. The American Journal of Human Genetics. 70 (1): 192–206. doi:10.1086/338457. PMC 384887. PMID 11731934. The SNPs used in the paper are P-M45, R1a1-M17, Q1a2-M3, and other xP-M45 SNPs. And the author mentions that, among ethnic groups in the paper, R1-M173 is harbored only in some eastern Siberian Udegeys and Koryaks and Native Americans. Also, R2 (distributed in India and its neighbours) cannot be found in far east Siberia. Thus, P-M45 except some samples mentioned above virtually means Q-M242 (xM3). In the paper, 35.3% of Nivkhs and 20.8% of Chukchi people and 18.2% of Siberian Eskimos are shown in P-M45, and 12.5% of Chukchis and 21.2% of Siberian Eskimos are in Q-M3. All of them can be estimated to be in haplogroup Q.
  37. 37,0 37,1 Pakendorf, Brigitte; Novgorodov, Innokentij N.; Osakovskij, Vladimir L.; Danilova, Al’Bina P.; Protod’Jakonov, Artur P.; Stoneking, Mark (2006). „Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts“. Human Genetics. 120 (3): 334–353. doi:10.1007/s00439-006-0213-2. PMID 16845541.
  38. 38,0 38,1 Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; Omoto, Keiichi; Harihara, Shinji; Stoneking, Mark; Horai, Satoshi (2005). „Dual origins of the Japanese: Common ground for hunter-gatherer and farmer Y chromosomes“. Journal of Human Genetics. 51 (1): 47–58. doi:10.1007/s10038-005-0322-0. PMID 16328082.
  39. 39,0 39,1 39,2 „Genetic evidence supports demic diffusion of Han culture“. Nature. 431 (7006): 302–5. September 2004. Bibcode:2004Natur.431..302W. doi:10.1038/nature02878. PMID 15372031. Supplementary Table 2: NRY haplogroup distribution in Han populations
  40. 40,0 40,1 40,2 40,3 Su, Bing; Xiao, Chunjie; Deka, Ranjan; Seielstad, Mark T.; Kangwanpong, Daoroong; Xiao, Junhua; Lu, Daru; Underhill, Peter; и др. (2000). „Y chromosome haplotypes reveal prehistorical migrations to the Himalayas“. Human Genetics. 107 (6): 582–90. doi:10.1007/s004390000406. PMID 11153912.
  41. 41,0 41,1 41,2 41,3 41,4 Gayden, Tenzin; и др. (May 2007). „The Himalayas as a Directional Barrier to Gene Flow“. The American Journal of Human Genetics. 80 (5): 884–894. doi:10.1086/516757. PMC 1852741. PMID 17436243.
  42. 42,0 42,1 42,2 Kim, Soon-Hee; и др. (2011). „High frequencies of Y-chromosome haplogroup O2b-SRY465 lineages in Korea: a genetic perspective on the peopling of Korea“. Investigative Genetics. 2 (1): 10. doi:10.1186/2041-2223-2-10. PMC 3087676. PMID 21463511.
  43. 43,0 43,1 Karafet, Tatiana M.; Hallmark, Brian; Cox, Murray P.; и др. (2010). „Major East–West Division Underlies Y Chromosome Stratification across Indonesia“. Mol. Biol. Evol. 27 (8): 1833–1844. doi:10.1093/molbev/msq063. PMID 20207712.
  44. 44,0 44,1 44,2 44,3 44,4 Trejaut, J.A. (2014). „Taiwan Y-chromosomal DNA variation and its relationship with Island Southeast Asia“. BMC Genetics. 15: 77. doi:10.1186/1471-2156-15-77. PMC 4083334. PMID 24965575.
  45. 45,0 45,1 45,2 „The Y Chromosome Consortium 2008“. Архивирано од изворникот на 2008-09-22. Посетено на 2010-07-17.
  46. 46,0 46,1 46,2 46,3 46,4 46,5 46,6 Cristofaro; и др. (2013). „Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge“. PLOS ONE. 8 (10): e76748. Bibcode:2013PLoSO...876748D. doi:10.1371/journal.pone.0076748. PMC 3799995. PMID 24204668.
  47. Dulik, M C (Feb 2012). „Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaian“. The American Journal of Human Genetics. 90 (2): 229–246. doi:10.1016/j.ajhg.2011.12.014. PMC 3276666. PMID 22281367.
  48. 48,0 48,1 48,2 48,3 Malyarchuk, Boris; и др. (2011). „Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a“. Journal of Human Genetics. 56 (8): 583–588. doi:10.1038/jhg.2011.64. PMID 21677663.
  49. KHARKOV, Vladimir Nikolaevich, "СТРУКТУРА И ФИЛОГЕОГРАФИЯ ГЕНОФОНДА КОРЕННОГО НАСЕЛЕНИЯ СИБИРИ ПО МАРКЕРАМ Y-ХРОМОСОМЫ," Genetika 03.02.07 and "АВТОРЕФЕРАТ диссертации на соискание учёной степени доктора биологических наук," Tomsk 2012
  50. Derenko, Miroslava; Malyarchuk, Boris; Denisova, Galina A.; и др. (2006). „Contrasting patterns of Y-chromosome variation in South Siberian populations from Baikal and Altai-Sayan regions“. Hum Genet. 118 (5): 591–604. doi:10.1007/s00439-005-0076-y. PMID 16261343.
  51. Yong-Ke, Zhang; Zheng, Chen; An, FAN; и др. (2009). „Genetic relationships between Tuva population and the neighboring populations in the Altai Region of Xinjiang Uygur Autonomous Region“. Yi Chuan = Hereditas. 31 (8): 818–824. doi:10.3724/SP.J.1005.2009.00818. PMID 19689942.
  52. E. J. VAJDA, "Siberian Link with Na-Dene Languages." The Dene–Yeniseian Connection, ed. by J. Kari and B. Potter(2010), pp.33–99, Anthropological Papers of the University of Alaska, new series, vol. 5(2010), Fairbanks: University of Alaska Fairbanks, Department of Anthropology
  53. E. G. Pulleyblank, "The consonontal system of old Chinese" [Pt 1], Asia Major, vol. IX (1962), pp. 1–2
  54. E. J. Vajda, Yeniseian Peoples and Languages: A History of Yeniseian Studies with an Annotated Bibliography and a Source Guide (2013, Oxford/New York, Routledge) pp.103-106, etc.
  55. „Did the Xiong-nu speak a Yeniseian language?“. Central Asiatic Journal. 44 (1): 87–104. 2000.
  56. „Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia“. Eur. J. Hum. Genet. 17 (10): 1260–73. March 2009. doi:10.1038/ejhg.2009.6. PMC 2986641. PMID 19259129.
  57. Karafet, Tatiana M.; Osipova, Ludmila P.; Savina, Olga V.; и др. (2018). „Siberian genetic diversity reveals complex origins of the Samoyedic-speaking populations“. American Journal of Human Biology. 30 (6): e23194. doi:10.1002/ajhb.23194. PMID 30408262.
  58. Yan, Shi; Chuan-; Wang, Chao; Li, Hui; и др. (2011). „An updated tree of Y-chromosome Haplogroup O and revised phylogenetic positions of mutations P164 and PK4“. European Journal of Human Genetics. 19 (9): 1013–1015. doi:10.1038/ejhg.2011.64. PMC 3179364. PMID 21505448.
  59. Zhong, Hua; Shi, Hong; Qi, Xue-Bin; Duan, Zi-Yuan; Tan, Ping-Ping; Jin, Li; Su, Bing; Ma, Runlin Z. (2011). „Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route“. Mol. Biol. Evol. 28 (1): 717–727. doi:10.1093/molbev/msq247. PMID 20837606.
  60. Zhong, Hua; Shi, Hong; Qi, Xue-Bin; Duan, Zi-Yuan; Tan, Ping-Ping; Jin, Li; Su, Bing; Ma, Runlin Z. (2011). „Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route“. Mol. Biol. Evol. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. 28 (1): 717–727. doi:10.1093/molbev/msq247. PMID 20837606. Архивирано од изворникот (PDF) на 2020-05-07.
  61. Zhao, Yong-Bin; Zhang, Ye; Li, Hong-Jie; Cui, Ying-Qiu; Zhu, Hong; Zhou, Hui (Nov–Dec 2014). „Ancient DNA evidence reveals that the Y chromosome haplogroup Q1a1 admixed into the Han Chinese 3,000 years ago“. Am J Hum Biol. 26 (6): 813–21. doi:10.1002/ajhb.22604. PMID 25130911.
  62. Zhao, Yong-Bin; Zhang, Ye; Zhang, Quan-Chao; Li, Hong-Jie; Cui, Ying-Qiu; Xu, Zhi; Jin, Li; Zhou, Hui; Zhu, Hong (May 4, 2015). „Ancient DNA Reveals That the Genetic Structure of the Northern Han Chinese Was Shaped Prior to 3,000 Years Ago“. PLOS ONE. 10 (5): e0125676. Bibcode:2015PLoSO..1025676Z. doi:10.1371/journal.pone.0125676. PMC 4418768. PMID 25938511.
  63. Lu Yan (2011), "Genetic Mixture of Populations in Western China." Shanghai: Fudan University, 2011: 1-84. (Doctoral dissertation in Chinese: 陆艳, “中国西部人群的遗传混合”, 上海:复旦大学,2011: 1-84.)
  64. 64,0 64,1 64,2 LIU, Shuhu; NIZAM, Yilihamu; RABIYAMU, Bake; ABDUKERAM, Bupatima; DOLKUN, Matyusup (February 2018). „应用Y染色体SNP对新疆三个隔离人群遗传多样性的研究 - 中国知网“ [A study of genetic diversity of three isolated populations in Xinjiang using Y-SNP]. Acta Anthropologica Sinica (Chinese). 37 (1): 146–156. doi:10.16359/j.cnki.cn11-1963/q.2017.0067.CS1-одржување: непрепознаен јазик (link)
  65. Shan; и др. (Sep 2014). „Genetic polymorphism of 17 Y chromosomal STRs in Kazakh and Uighur populations from Xinjiang, China“. Int J Legal Med. 128 (5): 743–4. doi:10.1007/s00414-013-0948-y. PMID 24398978.
  66. 66,0 66,1 66,2 66,3 Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; и др. (2006). „Dual origins of the Japanese: common ground for hunter-gatherer and farmer Y chromosomes“. Journal of Human Genetics. 51 (1): 47–58. doi:10.1007/s10038-005-0322-0. PMID 16328082.
  67. Qi, Xuebin; Cui, Chaoying; Peng, Yi; и др. (2013). „Genetic Evidence of Paleolithic Colonization and Neolithic Expansion of Modern Humans on the Tibetan Plateau“. Mol. Biol. Evol. 30 (8): 1761–1778. doi:10.1093/molbev/mst093. PMID 23682168.
  68. Kim, Soon-Hee; и др. (Nov 2010). „'Y chromosome homogeneity in the Korean population“. Int J Legal Med. 124 (6): 653–7. doi:10.1007/s00414-010-0501-1. PMID 20714743.
  69. Jin Park, Myung; и др. (2012). „Understanding the Y chromosome variation in Korea-relevance of combined haplogroup and haplotype analyses“. International Journal of Legal Medicine. 126 (4): 589–599. doi:10.1007/s00414-012-0703-9. PMID 22569803.
  70. The frequencies of Q-M242 shown in both studies (Kim2010, Park2012) are 1.4% (7/506, Kim) and 1.8% (13/706, Park) respectively. But, if recalculated by regional population weights, the adjusted frequencies reach 1.87% (Kim) and 1.91% (Park) respectively, converging to 1.9%.
  71. Peter A. Underhill, Peidong Shen, Alice A. Lin, et al. (2000), "Y chromosome sequence variation and the history of human populations." Nature Genetics, Volume 26, November 2000.
  72. Xue, Yali; Zerjal, Tatiana; Bao, Weidong; Zhu, Suling; Shu, Qunfang; Xu, Jiujin; Du, Ruofu; Fu, Songbin; Li, Pu (April 2006). „Male Demography in East Asia: A North–South Contrast in Human Population Expansion Times“. Genetics. 172 (4): 2431–2439. doi:10.1534/genetics.105.054270. PMC 1456369. PMID 16489223.
  73. 73,0 73,1 73,2 Nonaka, I.; Minaguchi, K.; Takezaki, N. (2007). „Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms“ (PDF). Annals of Human Genetics. 71 (4): 480–495. doi:10.1111/j.1469-1809.2006.00343.x. PMID 17274803. |hdl-access= бара |hdl= (help)
  74. 74,0 74,1 74,2 74,3 Poznik, G. David; Xue, Yali; Mendez, Fernando L.; и др. (June 2016). „Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences“. Nature Genetics. 48 (6): 593–599. doi:10.1038/ng.3559. PMC 4884158. PMID 27111036.
  75. 75,0 75,1 Wang C-C, Wang L-X; Shrestha, R; Zhang, M; Huang, X-Y; и др. (2014). „Genetic Structure of Qiangic Populations Residing in the Western Sichuan Corridor“. PLOS ONE. 9 (8): e103772. Bibcode:2014PLoSO...9j3772W. doi:10.1371/journal.pone.0103772. PMC 4121179. PMID 25090432.
  76. Yamamoto, Toshimichi; Senda, Tomoki; Horiba, Daiki; Sakuma, Masayoshi; Kawaguchi, Yuuka; Kano, Yuuichi (2013). „Y-chromosome lineage in five regional Mongolian populations“. Forensic Science International: Genetics Supplement Series. 4 (1): e260–e261. doi:10.1016/j.fsigss.2013.10.133.
  77. 77,0 77,1 77,2 Karafet, TM; и др. (Feb 2005). „Balinese Y-chromosome perspective on the peopling of Indonesia: genetic contributions from pre-neolithic hunter-gatherers, Austronesian farmers, and Indian traders“. Hum. Biol. 77 (1): 93–114. doi:10.1353/hub.2005.0030. PMID 16114819. |hdl-access= бара |hdl= (help)
  78. 78,0 78,1 He, J-D; Peng, M-S; Quang, HH; Dang, KP; Trieu, AV; и др. (2012). „Patrilineal Perspective on the Austronesian Diffusion in Mainland Southeast Asia“. PLOS ONE. 7 (5): e36437. Bibcode:2012PLoSO...736437H. doi:10.1371/journal.pone.0036437. PMC 3346718. PMID 22586471.
  79. Enrico Macholdt, Leonardo Arias, Nguyen Thuy Duong, et al., "The paternal and maternal genetic history of Vietnamese populations." European Journal of Human Genetics (2020) 28:636–645. https://doi.org/10.1038/s41431-019-0557-4
  80. Peng, Min-Sheng; и др. (Aug 2014). „Retrieving Y chromosomal haplogroup trees using GWAS data“. Eur J Hum Genet. 22 (8): 1046–1050. doi:10.1038/ejhg.2013.272. PMC 4350590. PMID 24281365.
  81. Turspekov; и др. (2012). „The Kazakhstan DNA project hits first hundred Y-profiles for ethnic Kazakhs“. The Russian Journal of Genetic Genealogy. 2: 1.
  82. 82,0 82,1 82,2 82,3 82,4 82,5 Wells, R. Spencer; Yuldasheva, Nadira; Ruzibakiev, Ruslan; Underhill, Peter A.; Evseeva, Irina; Blue-Smith, Jason; Jin, Li; Su, Bing; Pitchappan, Ramasamy (28 August 2001). „The Eurasian Heartland: A continental perspective on Y-chromosome diversity“. Proceedings of the National Academy of Sciences of the United States of America. 98 (18): 10244–10249. Bibcode:2001PNAS...9810244W. doi:10.1073/pnas.171305098. PMC 56946. PMID 11526236.
  83. 83,0 83,1 83,2 Seielstad, Mark; и др. (Sep 2003). „A Novel Y-Chromosome Variant Puts an Upper Limit on the Timing of First Entry into the Americas“. The American Journal of Human Genetics. 73 (3): 700–705. doi:10.1086/377589. PMC 1180698. PMID 12929085.
  84. E. E. Ashirbekov, D. M. Botbaev, A. M. Belkozhaev, A. O. Abayldaev, A. S. Neupokoeva, J. E. Mukhataev, B. Alzhanuly, D. A. Sharafutdinova, D. D. Mukushkina, M. B. Rakhymgozhin, A. K. Khanseitova, S. A. Limborska, and N. A. Aytkhozhina, "Distribution of Y-Chromosome Haplogroups of the Kazakh from the South Kazakhstan, Zhambyl, and Almaty Regions." Reports of the National Academy of Sciences of the Republic of Kazakhstan, ISSN 2224-5227, Volume 6, Number 316 (2017), 85 - 95.
  85. Malyarchuk, B; и др. (Jan 2013). „Y-chromosome variation in Tajiks and Iranians“. Ann. Hum. Biol. 40 (1): 48–54. doi:10.3109/03014460.2012.747628. PMID 23198991.
  86. Karafet; и др. (Sep 2001). „Paternal Population History of East Asia: Sources, Patterns, and Microevolutionary Processes“. The American Journal of Human Genetics. 69 (3): 615–628. doi:10.1086/323299. PMC 1235490. PMID 11481588.
  87. Di Cristofaro, Julie; Pennarun, Erwan; Mazières, Stéphane; Myres, Natalie M.; Lin, Alice A.; Temori, Shah Aga; Metspalu, Mait; Metspalu, Ene; Witzel, Michael (2013-10-18). „Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge“. PLOS ONE. 8 (10): e76748. Bibcode:2013PLoSO...876748D. doi:10.1371/journal.pone.0076748. PMC 3799995. PMID 24204668.
  88. 88,0 88,1 Grugni, Viola; и др. (2012). „Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians“. PLOS ONE. 7 (7): e41252. Bibcode:2012PLoSO...741252G. doi:10.1371/journal.pone.0041252. PMC 3399854. PMID 22815981.
  89. 89,0 89,1 Regueiro, M.; Cadenas, A.M.; Gayden, T.; Underhill, P.A.; Herrera, R.J. (2006). „Iran: Tricontinental Nexus for Y-Chromosome Driven Migration“. Human Heredity. 61 (3): 132–143. doi:10.1159/000093774. PMID 16770078.
  90. 90,0 90,1 90,2 Bekada, Asmahan; и др. (2013). „Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape“. PLOS ONE. 8 (2): e56775. Bibcode:2013PLoSO...856775B. doi:10.1371/journal.pone.0056775. PMC 3576335. PMID 23431392.
  91. The frequency of Q is 4% (6/150, all Q-M25) in Regueiro 2006, in which it is 9.1% (3/33) in north Iran and 2.6% (3/117) in south Iran. But, since more people live in the northern regions, if recalculated by population weights, the frequency will reach about 6%. It is also 6.2% (35/566) in Bekada 2013 with a large-scale sampling.
  92. Al-Zahery, Nadia; и др. (2011). „In search of the genetic footprints of Sumerians: a survey of Y-chromosome and mtDNA variation in the Marsh Arabs of Iraq“. BMC Evolutionary Biology. 11 (1): 288. Bibcode:2011BMCEE..11..288A. doi:10.1186/1471-2148-11-288. PMC 3215667. PMID 21970613.
  93. 93,0 93,1 „Y-chromosome diversity characterizes the Gulf of Oman“. Eur. J. Hum. Genet. 16 (3): 374–86. March 2008. doi:10.1038/sj.ejhg.5201934. PMID 17928816.
  94. 94,0 94,1 94,2 Abu-Amero, Khaled K.; Hellani, Ali; Gonzalez, Ana M.; Larruga, Jose M; Cabrera, Vicente M; Underhill, Peter A (2009). „Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions“. BMC Genetics. 10 (1): 59. doi:10.1186/1471-2156-10-59. PMC 2759955. PMID 19772609.
  95. „Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events“. Am. J. Hum. Genet. 82 (4): 873–82. April 2008. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297.
  96. 96,0 96,1 „Excavating Y-chromosome haplotype strata in Anatolia“. Hum. Genet. 114 (2): 127–48. January 2004. doi:10.1007/s00439-003-1031-4. PMID 14586639.
  97. Gokcumen, Omer (2008). Ethnohistorical and Genetic Survey of Four Central Anatolian Settlements. University of Pennsylvania. ISBN 978-0-549-80966-1. Посетено на May 13, 2014.
  98. Firasat, Sadaf; Khaliq, Shagufta; Mohyuddin, Aisha; Papaioannou, Myrto; Tyler-Smith, Chris; Underhill, Peter A; Ayub, Qasim (2007). „Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan“. European Journal of Human Genetics. 15 (1): 121–126. doi:10.1038/sj.ejhg.5201726. PMC 2588664. PMID 17047675.
  99. 99,0 99,1 99,2 99,3 99,4 Sengupta, Sanghamitra; Zhivotovsky, Lev A.; King, Roy; Mehdi, S.Q.; Edmonds, Christopher A.; Cheryl-, Cheryl-Emiliane T.; Chow, Emiliane T.; Lin, Alice A.; и др. (2006). „Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists“. The American Journal of Human Genetics. 78 (2): 202–221. doi:10.1086/499411. PMC 1380230. PMID 16400607.
  100. Khurana, P; и др. (2014). „Y Chromosome Haplogroup Distribution in Indo-European Speaking Tribes of Gujarat, Western India“. PLOS ONE. 9 (3): e90414. Bibcode:2014PLoSO...990414K. doi:10.1371/journal.pone.0090414. PMC 3948632. PMID 24614885.
  101. Fornarino, Simona; и др. (2009). „Mitochondrial and Y-chromosome diversity of the Tharus (Nepal): a reservoir of genetic variation“. BMC Evol. Biol. 9 (1): 154. Bibcode:2009BMCEE...9..154F. doi:10.1186/1471-2148-9-154. PMC 2720951. PMID 19573232.
  102. Nahar Gazi, Nurun; и др. (2013). „Genetic Structure of Tibeto-Burman Populations of Bangladesh: Evaluating the Gene Flow along the Sides of Bay-of-Bengal“. PLOS ONE. 8 (10): e75064. Bibcode:2013PLoSO...875064G. doi:10.1371/journal.pone.0075064. PMC 3794028. PMID 24130682.
  103. Malyarchuk, B. A.; и др. (2008). „Gene Pool Structure of Russian Populations from the European Part of Russia Inferred from the Data on Y Chromosome Haplogroups Distribution“. Russian Journal of Genetics. 44 (2): 187–192. doi:10.1134/S1022795408020105.
  104. Khar'kov, VN; и др. (Aug 2005). „Frequencies of Y chromosome binary haplogroups in Belarussians“. Genetika. 41 (8): 1132–6. doi:10.1007/s11177-005-0182-x. PMID 16161635.
  105. „Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy“.
  106. Ehler, Edvard; и др. (Jun 2011). „Y-chromosomal diversity of the Valachs from the Czech Republic: model for isolated population in Central Europe“. Croat Med J. 52 (3): 358–367. doi:10.3325/cmj.2011.52.358. PMC 3131682. PMID 21674832.
  107. „Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy“.
  108. „Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy“.
  109. Varzari, Alexander; и др. (2013). „Paleo-Balkan and Slavic Contributions to the Genetic Pool of Moldavians: Insights from the Y Chromosome“. PLOS ONE. 8 (1): e53731. Bibcode:2013PLoSO...853731V. doi:10.1371/journal.pone.0053731. PMC 3547065. PMID 23341985.
  110. Karachanak, Sena; и др. (2013). „Y-Chromosome Diversity in Modern Bulgarians: New Clues about Their Ancestry“. PLOS ONE. 8 (3): e56779. Bibcode:2013PLoSO...856779K. doi:10.1371/journal.pone.0056779. PMC 3590186. PMID 23483890.
  111. Csányi, B.; и др. (July 2008). „Y-Chromosome Analysis of Ancient Hungarian and Two Modern Hungarian-Speaking Populations from the Carpathian Basin“. Annals of Human Genetics. 72 (4): 519–534. doi:10.1111/j.1469-1809.2008.00440.x. PMID 18373723.
  112. Hungarian Bukovina
  113. Q-L712 Subclades of haplogroup Q-M25: Q-L712, Q-L715, Q-L713, Q-YP789
  114. „Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy“.
  115. 115,0 115,1 115,2 David K. Faux, 2007, The Genetic Link of the Viking – Era Norse to Central Asia: An Assessment of the Y Chromosome DNA, Archaeological, Historical and Linguistic Evidence, http://www.davidkfaux.org/CentralAsiaRootsofScandinavia-Y-DNAEvidence.pdf
  116. „Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy“.
  117. Allison Mann, Vikings, merchants, and pirates at the top of the world : Y-chromosomal signatures of recent and ancient migrations in the Faroe Islands, MA Thesis of University of Louisville, 2012.
  118. „Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy“.
  119. „Family Tree DNA - My FamilyTree DNA Latvia Project Website“.
  120. „Family Tree DNA - LITHUANIAN DNA“.
  121. „Family Tree DNA - Switzerland DNA Project“.
  122. 122,0 122,1 Wiik, Kalevi (2008). „Where did European Men Come From?“. Journal of Genetic Genealogy. 4: 35–85.
  123. Di Gaetano, Cornelia; и др. (Jan 2009). „Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome“. Eur J Hum Genet. 17 (1): 91–99. doi:10.1038/ejhg.2008.120. PMC 2985948. PMID 18685561.
  124. Brisighelli, F (2012). „Uniparental markers of contemporary Italian population reveals details on its pre-Roman heritage“. PLOS ONE. 7 (12): e50794. Bibcode:2012PLoSO...750794B. doi:10.1371/journal.pone.0050794. PMC 3519480. PMID 23251386. In Table S4, #BEL50 is estimated to be Q-M378 by haplotype, though it is shown as just P* (xR1).
  125. Behar, DM; и др. (Mar 2004). „Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-Jewish European populations“. Hum Genet. 114 (4): 354–65. doi:10.1007/s00439-003-1073-7. PMID 14740294.
  126. Adams, Susan M.; и др. (Dec 2008). „The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula“. The American Journal of Human Genetics. 83 (6): 725–736. doi:10.1016/j.ajhg.2008.11.007. PMC 2668061. PMID 19061982.
  127. Alain Farhi et al., Preliminary Results of Sephardic DNA Testing, AVOTAYNU Volume XXIII, Number 2 Summer 2007, p.10
  128. „Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events“. PLOS ONE. 7 (3): e34288. 2012. Bibcode:2012PLoSO...734288H. doi:10.1371/journal.pone.0034288. PMC 3314501. PMID 22470552.
  129. Ghiani, ME; Moral, P; Mitchell, RJ; Hernández, M; García-Moro, C; Vona, G (2006). „Y-chromosome-Specific STR haplotype data on the Rapanui population (Easter Island)“. Hum Biol. 78 (5): 565–78. doi:10.1353/hub.2007.0005. PMID 17506287.
  130. Grugni, Viola; Battaglia, Vincenza; Hooshiar Kashani, Baharak; Parolo, Silvia; Al-Zahery, Nadia; Achilli, Alessandro; Olivieri, Anna; Gandini, Francesca; Houshmand, Massoud (2012). „Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians“. PLOS ONE. 7 (7): e41252. Bibcode:2012PLoSO...741252G. doi:10.1371/journal.pone.0041252. PMC 3399854. PMID 22815981.
  131. Malyarchuk, Boris; Derenko, Miroslava; Denisova, Galina; Maksimov, Arkady; Wozniak, Marcin; Grzybowski, Tomasz; Dambueva, Irina; Zakharov, Ilya (2011). „Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a“. Journal of Human Genetics. 56 (8): 583–8. doi:10.1038/jhg.2011.64. PMID 21677663.
  132. Malyarchuk, Boris; Derenko, Miroslava; Denisova, Galina; Khoyt, Sanj; Woźniak, Marcin; Grzybowski, Tomasz; Zakharov, Ilya (2013). „Y-chromosome diversity in the Kalmyks at the ethnical and tribal levels“. Journal of Human Genetics. 58 (12): 804–811. doi:10.1038/jhg.2013.108. PMID 24132124.
  133. 133,0 133,1 133,2 133,3 133,4 133,5 133,6 Di Cristofaro, J; Pennarun, E; Mazières, S; Myres, NM; Lin, AA; и др. (2013). „Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge“. PLOS ONE. 8 (10): e76748. Bibcode:2013PLoSO...876748D. doi:10.1371/journal.pone.0076748. PMC 3799995. PMID 24204668.
  134. Cai, X; Qin, Z; Wen, B; Xu, S; Wang, Y; Lu, Yan; Wei, Lanhai; Wang, Chuanchao; Li, Shilin (2011). „Human Migration through Bottlenecks from Southeast Asia into East Asia during Last Glacial Maximum Revealed by Y Chromosomes“. PLOS ONE. 6 (8): e24282. Bibcode:2011PLoSO...624282C. doi:10.1371/journal.pone.0024282. PMC 3164178. PMID 21904623.
  135. Hallast, Pille; Batini, Chiara; Zadik, Daniel; и др. (2014). „The Y-Chromosome Tree Bursts into Leaf: 13,000 High-Confidence SNPs Covering the Majority of Known Clades“. Molecular Biology and Evolution. 32 (3): 661–673. doi:10.1093/molbev/msu327. PMC 4327154. PMID 25468874.
  136. Monika Karmin, Lauri Saag, Mário Vicente, et al. (2015), "A recent bottleneck of Y chromosome diversity coincides with a global change in culture." Genome Research 25:1–8. Published by Cold Spring Harbor Laboratory Press; ISSN 1088-9051/15; www.genome.org.
  137. Zalloua, Pierre A.; Xue, Y; Khalife, J; Makhoul, N; Debiane, L; Platt, DE; Royyuru, AK; Herrera, RJ; и др. (2008). „Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events“. American Journal of Human Genetics. 82 (4): 873–882. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297.
  138. „Learn about Y-DNA Haplogroup Q“. Wendy Tymchuk - Senior Technical Editor. Genebase Systems. 2008. Архивирано од изворникот на 2010-06-22. Посетено на 2009-11-21.
  139. Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon; и др. (2004). „Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation“. Human Mutation. 24 (3): 248–60. doi:10.1002/humu.20077. PMID 15300852. Q-M323 in 3/20=15% of a sample of Yemenite Jews.
  140. Zhong, H.; Shi, H.; Qi, X.-B.; Duan, Z.-Y.; Tan, P.-P.; Jin, L.; Su, B.; Ma, R. Z. (2010). „Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route“. Molecular Biology and Evolution. 28 (1): 717–27. doi:10.1093/molbev/msq247. PMID 20837606.
  141. Brook, Kevin Alan (2018). The Jews of Khazaria (3rd ed.), p. 204. Rowman & Littlefield.
  142. YFull - Experimental Y Tree, Y-SNP calls for Afontova Gora 2, Afantova had haplogroup Q1a1 and some type of R derived mtdna.
  143. Rasmussen, M.; Anzick, S.; и др. (February 2014). „The genome of a Late Pleistocene human from a Clovis burial site in western Montana“. Nature. 506 (7487): 225–229. Bibcode:2014Natur.506..225R. doi:10.1038/nature13025. PMC 4878442. PMID 24522598.
  144. Raff, Jennifer A.; Bolnick, Deborah A. (February 2014). „Genetic roots of the first Americans“. Nature. 506 (7487): 162–163. doi:10.1038/506162a. PMID 24522593.
  145. Rasmussen, Morten; Sikora, Martin; Albrechtsen, Anders; Korneliussen, Thorfinn Sand; Moreno-Mayar, J. Víctor; Poznik, G. David; Zollikofer, Christoph P. E.; Ponce De León, Marcia S.; Allentoft, Morten E. (2015). „The ancestry and affiliations of Kennewick Man“. Nature. 523 (7561): 455–458. Bibcode:2015Natur.523..455R. doi:10.1038/nature14625. PMC 4878456. PMID 26087396.
  146. Hollard et al., Strong genetic admixture in the Altai at the Middle Bronze Age revealed by uniparental and ancestry informative makers, Forensic Science International: Genetics, published online 4 June 2014
  147. „Q-YP1500 YTree“.
  148. 148,0 148,1 On Henbei, Pengyang, and Heigouliang, Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)
  149. Zhao, Yong-Bin; Zhang, Ye; Li, Hong-Jie; Cui, Ying-Qiu; Zhu, Hong; Zhou, Hui (November 2014). „Ancient DNA evidence reveals that the Y chromosome haplogroup Q1a1 admixed into the Han Chinese 3,000 years ago“. American Journal of Human Biology. 26 (6): 813–821. doi:10.1002/ajhb.22604. PMID 25130911.
  150. Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)
  151. L. L. Kang et al., Y chromosomes of ancient Hunnu people and its implication on the phylogeny of East Asian linguistic families (2013)
  152. Knowing the Xiongnu Culture in Eastern Tianshan Mountain from Tomb Heigouliang and Dongheigou Site at the Beginning of Xihan Dynasty, RenMeng, WangJianXin, 2008
  153. Qui, Y; и др. (2015). „Identification of kinship and occupant status in Mongolian noble burials of the Yuan dynasty through a multidisciplinary approach“. Phil. Trans. R. Soc. B370 (1660): 20130378. doi:10.1098/rstb.2013.0378. PMC 4275886. PMID 25487330.

Библиографија

[уреди | уреди извор]

Надворешни врски

[уреди | уреди извор]